abrB [2020-09-22 10:16:34]

transcriptional regulator of transition state genes

Locus: BSU_00370

Isoelectric point: 6.57

Molecular weight: 10.63 kDa

Protein length: 96 aa

Gene length: 291 bp

Function: regulation of gene expression during the transition from growth to stationary phase

Product: transcriptional regulator

Essential: no

Synonyms: cpsX,tolB

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transition state regulators
• Groups of genes → Phosphoproteins → Phosphorylation on a Ser residue

Gene

Coordinates: 44,848 → 45,138

Phenotypes of a mutant

• No swarming motility on B medium PubMed

The protein

Paralogous protein(s)

• SpoVT, Abh

Domains

• SpoVT-AbrB domain (aa 7-52) (according to UniProt)

Modification

• phosphorylated on Ser-86 PubMed by PrkC, PrkD, and YabT results in loss of DNA-binding activity PubMed

Effectors of protein activity

• interaction with AbbA results in inactivation of AbrB PubMed

Structure

• 1Z0R (N-terminal DNA recognition domain), PubMed
• 2MJG (full-length protein) PubMed

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: abrB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • Spo0A: repression, -P PubMed, in Spo0A regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • expressed at the onset of stationary phase PubMed

  Additional information

  • degradation of the abrB mRNA is triggered by base-pairing with RnaC PubMed

Biological materials

Mutant

• TT731 (aphA3)
• 1A935 (abrB::cat), PubMed, available at BGSC
• GP1548 (abrB::ermC), available in Stülke lab
• BKE00370 (ΔabrB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA, downstream forward: _UP4_TAATCATTTCTTGTACAAAA
• BKK00370 (ΔabrB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA, downstream forward: _UP4_TAATCATTTCTTGTACAAAA

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Stülke lab

Labs working on this gene/protein

• Richard Losick, Harvard Univ., Cambridge, USA homepage
• Mark Strauch, Baltimore, USA homepage

References

Reviews

Loading

The AbrB regulon

Loading

Other original publications

Loading